The monosporic isolation technique produced pure cultures. Eight isolates, all of them, were identified as belonging to the Lasiodiplodia genus. On PDA plates, the colony morphology resembled cotton; primary mycelia darkened to black-gray after seven days of growth. The reverse sides of the plates matched the front sides in color, as illustrated in Figure S1B. For further study, the isolate QXM1-2, a representative sample, was chosen. QXM1-2 conidia presented an oval or elliptic form, with a mean dimension of 116 µm by 66 µm, based on 35 specimens. Colorless and transparent conidia are observed in the early stages, which gradually turn dark brown and develop a single septum in subsequent stages (Figure S1C). Conidiophores produced conidia after nearly four weeks of cultivating them on a PDA plate (Figure S1D). Conidiophores, exhibiting a transparent cylindrical morphology, ranged in size from (64-182) m in length and (23-45) m in width (n = 35). Upon examination, the characteristics of the specimens were demonstrably congruent with the outlined description of Lasiodiplodia sp. According to Alves et al. (2008),. The genes encoding the internal transcribed spacer regions (ITS), the translation elongation factor 1-alpha (TEF1), and the -tubulin (TUB), identified with GenBank Accession Numbers OP905639, OP921005, and OP921006, respectively, were amplified and sequenced using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Alves et al. 2008), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. The subjects shared 998-100% homology for the ITS (504/505 bp) sequence with Lasiodiplodia theobromae strain NH-1 (MK696029). Furthermore, 998-100% homology was also found between their TEF1 (316/316 bp) and TUB (459/459 bp) sequences with those of strain PaP-3 (MN840491) and isolate J4-1 (MN172230), respectively. By utilizing MEGA7, a neighbor-joining phylogenetic tree was developed, incorporating all sequenced genetic loci. selleck compound As demonstrated in Figure S2, isolate QXM1-2 displayed a 100% bootstrap support value for its inclusion within the L. theobromae clade. To investigate pathogenicity, a 20 L conidia suspension (1106 conidia/mL) was used to inoculate three A. globosa cutting seedlings that had been wounded with a sterile needle at their stem base. Seedlings that were inoculated with 20 liters of sterilized water were used as the control. To retain moisture within the 80% relative humidity environment of the greenhouse, all the plants were enclosed in clear polyethylene bags. The experiment underwent a tripartite repetition. Typical stem rot manifested in the treated cutting seedlings seven days post-inoculation, with no such symptoms observed in the control seedlings (Figure S1E-F). Morphological characteristics coupled with ITS, TEF1, and TUB gene sequencing led to the isolation of the same fungal species from the diseased tissues of inoculated stems to demonstrate Koch's postulates. This pathogen has been observed to infect the castor bean plant's branch, a finding detailed by Tang et al. (2021), and the root of Citrus plants, as previously noted by Al-Sadi et al. (2014). This report, to our knowledge, details the first instance of L. theobromae infecting A. globosa in China. L. theobromae's biology and epidemiology are importantly addressed and referenced in this study.

Yellow dwarf viruses (YDVs) are responsible for diminishing grain yield in a wide variety of cereal hosts throughout the world. The Polerovirus genus encompasses cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS), both classified within the Solemoviridae family, as detailed by Scheets et al. (2020) and Somera et al. (2021). CYDV RPV, along with barley yellow dwarf virus PAV (BYDV PAV) and MAV (BYDV MAV) (both belonging to the Luteovirus genus, Tombusviridae family), is present globally. Yet, serological methods have been most often employed to identify its presence in Australia (Waterhouse and Helms 1985; Sward and Lister 1988). Previously unrecorded in Australia is the presence of CYDV RPS. A wheat (Triticum aestivum) plant specimen (226W), positioned near Douglas, Victoria, Australia, and exhibiting yellow-reddish leaf symptoms resembling YDV infection, had its sample collected in October 2020. The sample's TBIA (tissue blot immunoassay) analysis indicated a positive outcome for CYDV RPV, but a negative result for BYDV PAV and BYDV MAV, as documented by Trebicki et al. (2017). The serological capacity to detect both CYDV RPV and CYDV RPS necessitated the extraction of total RNA from stored leaf tissue belonging to plant sample 226W. This extraction was performed using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with a modified lysis buffer as outlined by Constable et al. (2007) and MacKenzie et al. (1997). To investigate CYDV RPS, the sample was subjected to RT-PCR using three distinct primer sets. These primers targeted three unique overlapping regions (each approximately 750 base pairs) near the 5' end of the viral genome, a region noted for the maximal divergence between CYDV RPV and CYDV RPS (Miller et al., 2002). The P0 gene was a target of the CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT) and CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) primers, while the CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) primer sets were designed to target different segments within the RdRp gene. All three primer sets indicated a positive outcome for sample 226W, and the subsequent sequencing of the amplified regions was performed directly. Comparative analyses using BLASTn and BLASTx algorithms demonstrated that the CYDV RPS1 amplicon (OQ417707) exhibited 97% nucleotide identity and 98% amino acid identity to the CYDV RPS isolate SW (LC589964) from South Korea. Likewise, the CYDV RPS2 amplicon (OQ417708) displayed 96% nucleotide and 98% amino acid identity to the same South Korean isolate. presymptomatic infectors A 96% nucleotide and 97% amino acid identity similarity was observed between the CYDV RPS3 amplicon (accession number OQ417709) and the CYDV RPS isolate Olustvere1-O (accession number MK012664) from Estonia, validating the identification of isolate 226W as a CYDV RPS isolate. To add, 13 plant samples, already found positive for CYDV RPV by the TBIA assay, underwent total RNA extraction and subsequent testing for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. Sample 226W and additional specimens, encompassing wheat (n=8), wild oat (Avena fatua, n=3), and brome grass (Bromus sp., n=2), were gathered simultaneously from seven fields in the same region. From fifteen wheat samples taken from the same field as sample 226W, only one tested positive for CYDV RPS, leaving the remaining twelve samples with negative test results. Our findings, to the best of our comprehension, present the first reported case of CYDV RPS in Australia. CYDV RPS's arrival in Australia, and its effects on cereal and grass harvests, are currently under scrutiny, with ongoing research to determine the virus's impact.

Xanthomonas fragariae, also known as X., is a bacterial plant pathogen. Infections by fragariae lead to the development of angular leaf spots (ALS) on strawberry plants. The X. fragariae strain YL19 was isolated in a recent Chinese study, demonstrating both typical ALS symptoms and dry cavity rot in strawberry crown tissue for the first time. medicines optimisation The strawberry cultivar is affected by a fragariae strain displaying both these impacts. This research, spanning the period from 2020 to 2022, resulted in the isolation of 39 X. fragariae strains from diseased strawberry plants located in varied production zones across China. Multi-locus sequence typing (MLST), coupled with phylogenetic analysis, revealed a genetic difference between X. fragariae strain YLX21 and YL19, as well as other strains. YLX21 and YL19 exhibited varying degrees of pathogenicity, as observed in tests involving strawberry leaves and stem crowns. Although YLX21 inoculation typically failed to elicit ALS symptoms in strawberries after wound application, it consistently induced severe ALS symptoms when applied via spray inoculation. Dry cavity rot, however, was rarely observed after wound inoculation and never observed following spray inoculation. Although other factors may be involved, YL19 induced a more pronounced symptom severity in strawberry crowns, observed across both conditions. Finally, YL19 showed a single polar flagellum, whereas YLX21 showcased a complete lack of a flagellum. Motility and chemotaxis experiments indicated weaker movement in YLX21 compared to YL19. This difference in motility possibly explains YLX21's preference to proliferate locally within strawberry leaves, instead of spreading to other plant tissues. This localized multiplication contributed to a more pronounced ALS phenotype and a comparatively mild crown rot response. Collectively, the new strain YLX21 provided insights into the critical factors impacting the pathogenicity of X. fragariae and the mechanism behind strawberry crown dry cavity rot formation.

Within China's agricultural system, the strawberry (Fragaria ananassa Duch.) is a widely cultivated crop of significant economic value. In Chenzui town, Wuqing district, Tianjin, China (117°01'E, 39°17'N), an unusual wilt disease was observed in six-month-old strawberry plants in April 2022. The incidence rate, within the 0.34 hectare greenhouses, ranged approximately from 50% to 75%. Seedling death commenced with wilting visible first on the outer leaves, subsequently encompassing the entire plant. The diseased seedlings' rhizomes, displaying a color change, suffered necrotic and rotten deterioration. For 30 seconds, symptomatic roots were surface disinfected using 75% ethanol, followed by three washes with sterile distilled water. Thereafter, the roots were divided into 3 mm2 pieces (four pieces per seedling) and placed on petri dishes containing potato dextrose agar (PDA) media with 50 mg/L streptomycin sulfate. These were then incubated in the dark at 26°C. After six days of cultivation, the growing tips of the fungal colonies were transferred to Potato Dextrose Agar. From 20 diseased root samples, 84 isolates, characterized by their morphological features, were found to belong to five distinct fungal species.